產(chǎn)品名稱 |
HFBCN94 |
商品貨號 |
B209449 |
Designations |
HFBCN94 |
GenBank Number |
M85806
|
Species |
Homo sapiens, human |
Applications |
The predicted product size is (bp): 112. The observed product size(s) is(are) (bp): 113 (human). |
Vector |
Construct size (kb): 5.25 DESCRIPTION OF VECTOR COMPONENT: Name of vector: pBluescript SK- Intact vector size: 2.960 Type of vector: phagemid Vector end: EcoRI Vector end: EcoRI Cloning sites: KpnI ApaI DraII XhoI (SalI HincII AccI) ClaI HindIII EcoRV EcoRI PstI SmaI BamHI SpeI XbaI EagI NotI SacII BstXI SacI Polylinker sites: SacI BstXI SacII NotI EagI XbaI SpeI BamHI SmaI PstI EcoRI EcoRV HindIII (ClaI Bsp106I) (HincII AccI SalI) XhoI (Eco0109I DraII ApaI) KpnI Construction: pUC19 Host range: Escherichia coli Features (with orientation and position when available): replicon: f1, -> insert detection: lacZ', <- primer site: M13-20, -> promoter: T7, -> MCS: KpnI...SacI, -> promoter: T3, <- promoter: lac, <- primer site: M13 reverse, <- replicon: pMB1 marker(s): ampR, <- Cross references: |
Insert |
DNA: cDNA DESCRIPTION OF INSERT COMPONENT: Genome: Homo sapiens Gene symbol: D5S1557E Genomic copy number: unique Gene name: DNA Segment, single copy, expressed Contains complete coding sequence?: U Chromosome: 5; Localization: 5 q31.3-q33.2 Tissue: fetal brain, female, 17-18 wk (Stratagene 936206) Type of DNA: cDNA Insert end: Modification: EcoRI linkers Insert end: Modification: EcoRI linkers Insert size (kb): 2.25 Cross references: DNA Seq. Acc.: M85806; EST: EST02327; Primer: M13 Reverse Insert lengths(kb): 2.25 Tissue: fetal brain, female, 17-18 wk (Stratagene 936206) Gene product: DNA Segment, single copy, expressed [D5S1557E] |
Insert Size (kb) |
2.25 |
Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Shipping Information |
Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--3.0, 2.25; PstI--3.8, 1.0, 0.5; HindIII--5.3. EST02327 can be detected in genomic DNA using the following oligonucleotides (5'-3'): CCCAGTAAACCCATCAGACT and ACATGTTTTGGGAGGGAC. EST02327 matches GenBank accession HUMBFXIII (GenBank M64554, human factor XIII b) with 83.06% identity over the sequence range: 61-125. EST02327 contains an O family repetitive element. Sequenced from the M13 reverse primer. The predicted product size is (bp): 112. The observed product size(s) is(are) (bp): 113 (human). Related product(s): oligonucleotides, ATCC 73231. |
References |
Feldblyum TV, et al. Regional assignment and tissue expression of twenty-three expressed sequence tags (ESTs) from human chromosome 5. Genomics 33: 128-130, 1996. PubMed: 8617497
Adams MD, et al. Sequence identification of 2,375 human brain genes. Nature 355: 632-634, 1992. PubMed: 1538749
J C Venter, personal communication
|